Rr49^em1Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr49^em1Axvi
• Name: regulatory region 49; endonuclease-mediated mutation 1, Axel Visel
• MGI ID: MGI:7489586
• Synonyms: B1
• Gene: Rr49 Location: unknown Genetic Position: Chr9, Syntenic
• Alliance: Rr49^em1Axvi page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The topologically associating domain (TAD) boundary region or insulator between Smad3 and Smad6, separating the Smad3 TAD from the Smad6 TAD, was targeted with sgRNAs (targeting CCTTATTGAACAGGCATCCACGG, GCTTTAAAGGGGAGACCTGAGGG, GAGTGAAACTGGGGGAATCGGGG and AGCTTGACTTAGCTACTTTGAGG) using CRISPR/Cas9 technology, resulting in an 80742 bp deletion (chr9:63749007-63829748 (GRCm39)). (J:335096)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr49 Mutation: 1 strain or line available

References

• Original: J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
• All: 1 reference(s)