Rr51^em1Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr51^em1Axvi
• Name: regulatory region 51; endonuclease-mediated mutation 1, Axel Visel
• MGI ID: MGI:7489587
• Synonyms: B2
• Gene: Rr51 Location: unknown Genetic Position: Chr5, Syntenic
• Alliance: Rr51^em1Axvi page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The topologically associating domain (TAD) boundary region or insulator between Tbx5 and Rbm19, separating the Tbx5 TAD from the Lhx5 TAD, was targeted with sgRNAs (targeting AGATCTAAGACAGCCATGACAGG, CACTTTAGTAAAGTGTTGGGTGG, TTACACACCAATAATTGGGGGGG and CATAGGATACAGATATGTTGAGG) using CRISPR/Cas9 technology, resulting in a 21118 bp deletion (chr5:120225179-120246296 (GRCm39)). (J:335096)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr51 Mutation: 1 strain or line available

References

• Original: J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
• All: 1 reference(s)