Del(5Rr426-Rr108735)1Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(5Rr426-Rr108735)1Axvi
• Name: deletion, Chr 5, Axel Visel 1
• MGI ID: MGI:7489863
• Synonyms: enhancer+CTCF delta
• Gene: Del(5Rr426-Rr108735)1Axvi Location: unknown Genetic Position: Chr5, Syntenic

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(5Rr426-Rr108735)1Axvi involves 2 genes/genome features (Rr426, Rr108735) View all
• Mutation details: A region containing Tbx5 lung enhancer Rr426, located downstream of the gene, and CTCF-binding sequence Rr108735 downstream of it, was targeted with sgRNAs (targeting ACTGGAAATCAAGACTGGGCAGG, GGAAACTGGAAATCAAGACTGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in a 1950 bp deletion (chr5:120239699-120241648 (GRCm39)). (J:335096)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(5Rr426-Rr108735)1Axvi Mutation: 0 strains or lines available

References

• Original: J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
• All: 1 reference(s)