Jade3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jade3^em1(IMPC)Tcp
• Name: jade family PHD finger 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7490169
• Gene: Jade3 Location: ChrX:20291927-20386178 bp, + strand Genetic Position: ChrX, 15.9 cM
• Alliance: Jade3^em1(IMPC)Tcp page
• IMPC: Jade3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATTTCCAGGCCGTGCTCAA and AAGCTTCTGTGCCCGTAGGC targeting within exon ENSMUSE00000326487. This resulted in a 161bp deletion of ChrX from 0377309 to 20377469 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Jade3 Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)