Tomt^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tomt^em1(IMPC)Tcp
• Name: transmembrane O-methyltransferase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7490176
• Gene: Tomt Location: Chr7:101549010-101555572 bp, - strand Genetic Position: Chr7, 54.68 cM
• Alliance: Tomt^em1(IMPC)Tcp page
• IMPC: Tomt gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCAATGGTCAAGCGTGGTG and AGCCACATGGGCCCTGTTAA within exon ENSMUSE00000671717. This resulted in a 15bp deletion of Chr7 from 101551254 to 101551268 (GRCm39) and a 1bp deletion of Chr 7 at 101551228, introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tomt Mutation: 14 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)