About   Help   FAQ
Atp6ap2em1Tiy
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp6ap2em1Tiy
Name: ATPase, H+ transporting, lysosomal accessory protein 2; endonuclease-mediated mutation 1, Tianxin Yang
MGI ID: MGI:7490239
Synonyms: PRRR279V/L282V
Gene: Atp6ap2  Location: ChrX:12454040-12483288 bp, + strand  Genetic Position: ChrX, 7.42 cM
Alliance: Atp6ap2em1Tiy page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 279 (AGG) and leucine codon 282 (CTT) in exon 8 were changed to valine (GTG, GTT) (p.R279V, p.L282V) using an sgRNA (targeting GAAGTCAAGGACCATCCTTGAGG) and ssODN template with CRISPR/Cas9 technology. These mutations block processing of the encoded peptide by FURIN (paired basic amino acid cleaving enzyme) and site 1 membrane-bound transcription factor peptidase (MBTPS1). (J:324586)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Atp6ap2 Mutation:  9 strains or lines available
References
Original:  J:324586 Wang F, et al., Mutagenesis of the Cleavage Site of Pro Renin Receptor Abrogates Angiotensin II-Induced Hypertension in Mice. Hypertension. 2021 Jul;78(1):115-127
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory