Inha^em1Crah
Endonuclease-mediated Allele Detail

Summary

• Symbol: Inha^em1Crah
• Name: inhibin alpha; endonuclease-mediated mutation 1, Craig A Harrison
• MGI ID: MGI:7491749
• Synonyms: Inha^R233A
• Gene: Inha Location: Chr1:75483872-75487010 bp, + strand Genetic Position: Chr1, 39.16 cM, cytoband C5
• Alliance: Inha^em1Crah page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 233 (CGT) in exon 2 was changed to alanine (GCG) (ENSMUST00000037330.5:c.697_699delinsGCG p.R233A) using an sgRNA (targeting GCACGGAGGGAGTTGAACGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R232A that blocks the inhibin function of the encoded peptide but preserves activin A/B production. (J:324311)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Inha Mutation: 9 strains or lines available

References

• Original: J:324311 Walton KL, et al., Inhibin Inactivation in Female Mice Leads to Elevated FSH Levels, Ovarian Overstimulation, and Pregnancy Loss. Endocrinology. 2022 Apr 1;163(4)
• All: 1 reference(s)