About   Help   FAQ
Cul3em1Limi
Endonuclease-mediated Allele Detail
Summary
Symbol: Cul3em1Limi
Name: cullin 3; endonuclease-mediated mutation 1, Lilia M Iakoucheva
MGI ID: MGI:7491948
Synonyms: Cul3-
Gene: Cul3  Location: Chr1:80242640-80318197 bp, - strand  Genetic Position: Chr1, 41.24 cM, cytoband C4
Alliance: Cul3em1Limi page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsA single nucleotide (A) was inserted (after GRCm39:g.80264764A) into exon 6 using an sgRNAs (targeting GGATTAATGAGGAAATAGAG) and an ssODN template with CRISPR/Cas9 technology. This frameshift mutation was generated next to the site of the human p.E246* mutation associated with autism spectrum disorder (ASD). (J:332937)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 11 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cul3 Mutation:  51 strains or lines available
References
Original:  J:332937 Amar M, et al., Autism-linked Cullin3 germline haploinsufficiency impacts cytoskeletal dynamics and cortical neurogenesis through RhoA signaling. Mol Psychiatry. 2021 Mar 16;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory