Iars1^em2Nsas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iars1^em2Nsas
• Name: isoleucyl-tRNA synthetase 1; endonuclease-mediated mutation 2, Nobuya Sasaki
• MGI ID: MGI:7493276
• Synonyms: IARS1^V79L, Iars^{em2(V79L)Nsas}
• Gene: Iars1 Location: Chr13:49835606-49887743 bp, + strand Genetic Position: Chr13, 25.38 cM
• Alliance: Iars1^em2Nsas page

Mutation origin

• Strain of Origin: C57BL/6JJcl

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Single point mutation
• Mutation details: Valine codon 79 (GTT) in exon 3 was changed to leucine (CTT) (NM_172015.3:c.235G>C, p.V79L) using a crRNA (targeting TGTCAACGTGAAACCCGCTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is associated with weak calf syndrome in cattle. (J:104881, J:340986)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Iars1 Mutation: 78 strains or lines available

References

• Original: J:104881 The RIKEN BioResource Center, Information obtained from The RIKEN BioResource Center. Unpublished. 2006-2013
• All: 2 reference(s)