Runx1em1Salr
Endonuclease-mediated Allele Detail
|
Symbol: |
Runx1em1Salr |
Name: |
runt related transcription factor 1; endonuclease-mediated mutation 1, Stephen A Liebhaber |
MGI ID: |
MGI:7495608 |
Synonyms: |
Runx1deltaE6 |
Gene: |
Runx1 Location: Chr16:92398354-92622962 bp, - strand Genetic Position: Chr16, 53.7 cM
|
Alliance: |
Runx1em1Salr page
|
|
Strain of Origin: |
(C57BL/6J x SJL/J)F2
|
|
Allele Type: |
|
Endonuclease-mediated (Modified isoform(s)) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: CRISPR/cas9 genome editing is used to delete exon 6. The intron 5 sgRNA (Runx1E6_gRNA.254, GGGCACCGAGTCCCAGACTG) was designed to target chromosome 16 (Chr 16) coordinates 92644590 to 92644609 (Mus musculus genomic assembly mm10) and the intron 6 sgRNA (Runx1E6_gRNA.121, GAAACCCCGCAGCATCAGCT) targeted to Chr 16, positions 92644031 to 92644050.
(J:265272)
|
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Runx1 Mutation: |
32 strains or lines available
|
|
Original: |
J:265272 Ghanem LR, et al., Poly(C)-Binding Protein Pcbp2 Enables Differentiation of Definitive Erythropoiesis by Directing Functional Splicing of the Runx1 Transcript. Mol Cell Biol. 2018 Aug 15;38(16) |
All: |
1 reference(s) |
|