Cfi^em1Jiwe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfi^em1Jiwe
• Name: complement component factor i; endonuclease-mediated mutation 1, Jiqiu Wen
• MGI ID: MGI:7507065
• Synonyms: CFI-D288G
• Gene: Cfi Location: Chr3:129630432-129668978 bp, + strand Genetic Position: Chr3, 59.21 cM
• Alliance: Cfi^em1Jiwe page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Aspartic acid codon 288 (GAC) in exon 6 was changed to glycine (GGC) (p.D288G) using sgRNAs (targeting ACCAATACAAGTGTAATGGTG and ACATATGTGTGATGTGCACG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.D283G mutation associated with C3 glomerulonephritis (C3GN). (J:308307)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cfi Mutation: 44 strains or lines available

References

• Original: J:308307 Song H, et al., Generation and Characterization of Mouse Models of C3 Glomerulonephritis With CFI D288G and P467S Mutations. Front Physiol. 2021;12:649801
• All: 1 reference(s)