Iqcm^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iqcm^em1(IMPC)Tcp
• Name: IQ motif containing M; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7510086
• Gene: Iqcm Location: Chr8:76175322-76711131 bp, + strand Genetic Position: Chr8, 35.65 cM, cytoband C2
• Alliance: Iqcm^em1(IMPC)Tcp page
• IMPC: Iqcm gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCGTGTGCTATGTCGATGC targeting the 5' side and TGACCCATATCCGGGCACAT targeting the 3' side of a critical region (ENSMUSE00000391111). This resulted in a 1128-bp deletion of Chr8 from 76351357 to 76352484 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Iqcm Mutation: 37 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)