Ptk2b^em2Yank
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptk2b^em2Yank
• Name: PTK2 protein tyrosine kinase 2 beta; endonuclease-mediated mutation 2, Yanping Kuang
• MGI ID: MGI:7511568
• Synonyms: PTK2B^Y402F
• Gene: Ptk2b Location: Chr14:66390706-66518501 bp, - strand Genetic Position: Chr14, 34.36 cM
• Alliance: Ptk2b^em2Yank page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 402 (TAT) in exon 13 was changed to phenylalanine (TTT) (p.Y402F) using an sgRNA and an ssODN template (GGGCTGGGCCCCTTTCTGTCATTACAGAGTCAGACATCTTTGCAGAGATTCCCGATGAGACCCTGCGAAGACCAGGAGG) with CRISPR/Cas9 technology. This mutation prevents autophosphorylation of the residue in the encoded peptide. (J:307509)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ptk2b Mutation: 57 strains or lines available

References

• Original: J:307509 Cong Y, et al., Ptk2b deletion improves mice folliculogenesis and fecundity via inhibiting follicle loss mediated by Erk pathway. J Cell Physiol. 2021 Feb;236(2):1043-1053
• All: 1 reference(s)