Pigk^em2Linwu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pigk^em2Linwu
• Name: phosphatidylinositol glycan anchor biosynthesis, class K; endonuclease-mediated mutation 2, Lingqian Wu
• MGI ID: MGI:7511852
• Synonyms: Pigk^D204H
• Gene: Pigk Location: Chr3:152419718-152548705 bp, + strand Genetic Position: Chr3, 77.16 cM, cytoband H4
• Alliance: Pigk^em2Linwu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Aspartic acid codon 204 (GAC) in exon 7 was changed to histidine (CAC) (p.D204H) using an sgRNA (targeting GTTCATTATTGACACTTGCC) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with severe infantile encephalopathy. (J:305399)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pigk Mutation: 25 strains or lines available

References

• Original: J:305399 Chen X, et al., Loss of PIGK function causes severe infantile encephalopathy and extensive neuronal apoptosis. Hum Genet. 2021 May;140(5):791-803
• All: 1 reference(s)