About   Help   FAQ
4930444P10Rikem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: 4930444P10Rikem1(IMPC)Tcp
Name: RIKEN cDNA 4930444P10 gene; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7512899
Gene: 4930444P10Rik  Location: Chr1:16136203-16163549 bp, - strand  Genetic Position: Chr1, 4.94 cM, cytoband A3
Alliance: 4930444P10Rikem1(IMPC)Tcp page
IMPC: 4930444P10Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTCCTCCCTGTGGTCAATA targeting the 5' side and AGGGGTTATTCACAACATGC targeting the 3' side of a critical region (ENSMUSE00001163295). This resulted in a 959-bp deletion of Chr1 from 16148033 to 16148991 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any 4930444P10Rik Mutation:  10 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory