Gng12^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gng12^em1(IMPC)Tcp
• Name: guanine nucleotide binding protein (G protein), gamma 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7512907
• Gene: Gng12 Location: Chr6:66873381-66998334 bp, + strand Genetic Position: Chr6, 30.68 cM
• Alliance: Gng12^em1(IMPC)Tcp page
• IMPC: Gng12 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTGGTGCTTGCCGTCTTGC (within ENSMUSE00000256838) and CGGAGCGACCCCCTGCTGAT(within exon ENSMUSE00001368854). This resulted in a 1769bp deletion of Chr6 from 66992743 to 66994511 with insertion of A and a T>C at 66992738 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gng12 Mutation: 46 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)