Dimt1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dimt1^em1(IMPC)J
• Name: DIM1 rRNA methyltransferase and ribosome maturation factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7515012
• Gene: Dimt1 Location: Chr13:107083635-107096732 bp, + strand Genetic Position: Chr13, 58.06 cM, cytoband D1
• Alliance: Dimt1^em1(IMPC)J page
• IMPC: Dimt1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCAATCGGTTCTACTGGT and TTCTGGCAAGAAACACAGGG, which resulted in a 1536 bp deletion beginning at Chromosome 13 position 106,948,451 bp and ending after 106,949,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120073, ENSMUSE00000120072, ENSMUSE00000120070, ENSMUSE00000311714 (exons 3,4,5 and 6) and 1243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dimt1 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)