About   Help   FAQ
Wdr5em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr5em1Tcp
Name: WD repeat domain 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7516888
Gene: Wdr5  Location: Chr2:27405169-27426547 bp, + strand  Genetic Position: Chr2, 19.38 cM
Alliance: Wdr5em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking four exons, ENSMUSE00001206138, ENSMUSE0000016411, ENSMUSE00000164106, and ENSMUSE00000164101 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdr5 Mutation:  30 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory