Metap1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Metap1^em1(IMPC)Tcp
• Name: methionyl aminopeptidase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7517093
• Gene: Metap1 Location: Chr3:138164721-138195143 bp, - strand Genetic Position: Chr3, 64.27 cM
• Alliance: Metap1^em1(IMPC)Tcp page
• IMPC: Metap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATACTCGTATTAGGTATTGA targeting the 5' side and TGTAAAGGCATCGTGAAAAC targeting the 3' side of a critical region (ENSMUSE00000176809, ENSMUSE00000176812 and ENSMUSE00000176807). This resulted in a 8050-bp deletion of Chr3 from 138181167 to 138189216 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Metap1 Mutation: 30 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)