Rorcem1(Thy1)Aben
Endonuclease-mediated Allele Detail
|
Symbol: |
Rorcem1(Thy1)Aben |
Name: |
RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Albert Bendelac |
MGI ID: |
MGI:7518202 |
Synonyms: |
RorcThy1.1 |
Gene: |
Rorc Location: Chr3:94280106-94305583 bp, + strand Genetic Position: Chr3, 40.56 cM, cytoband F2
|
Alliance: |
Rorcem1(Thy1)Aben page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Inserted expressed sequence) |
Mutation: |
|
Insertion
|
|
|
Rorcem1(Thy1)Aben expresses
1 gene
Knock-in expresses:
Organism |
Expressed Gene |
Note |
mouse |
Thy1 (MGI:98747) |
a variant |
|
|
|
Mutation details: CRISPR/cas9 genome editing used a guide crRNA [GTCCTACAAGGCAAGCCTAG] to insert an internal ribosomal entry site (IRES)/thymus cell antigen 1, theta (Thy1.1) a variant sequence into the 3' UTR of the gene. Rorc transcript Rorc-201 (ENSMUST00000029795.10) was used as reference for the exon number and guide sequences.
(J:307783)
|
|
|
|
Original: |
J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2) |
All: |
1 reference(s) |
|