Mplkip^em2Nimo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mplkip^em2Nimo
• Name: M-phase specific PLK1 intereacting protein; endonuclease-mediated mutation 2, Nima Mosammaparast
• MGI ID: MGI:7518887
• Synonyms: Ttdn1^delta, Ttdn1^delta34
• Gene: Mplkip Location: Chr13:17869998-17873697 bp, + strand Genetic Position: Chr13, 6.05 cM, cytoband A3.1
• Alliance: Mplkip^em2Nimo page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Methionine codon 143 in exon 2 was targeted for change to valine using an sgRNA (targeting TTCAATGCTTGAAGACCCTTNGG) and an ssODN template with CRISPR/Cas9 technology. Besides the intended allele (Mplkip^em1Nimo), this also created this allele that has a 34 bp deletion (TGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCT), which leads to a frameshift and premature stop codon. No protein is expressed from this allele. (J:338438)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mplkip Mutation: 15 strains or lines available

References

• Original: J:338438 Townley BA, et al., A functional link between lariat debranching enzyme and the intron-binding complex is defective in non-photosensitive trichothiodystrophy. Mol Cell. 2023 Jul 6;83(13):2258-2275.e11
• All: 1 reference(s)