Eid3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eid3^em1(IMPC)J
• Name: EP300 interacting inhibitor of differentiation 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7518987
• Gene: Eid3 Location: Chr10:82702460-82703764 bp, + strand Genetic Position: Chr10, 40.66 cM, cytoband C1
• Alliance: Eid3^em1(IMPC)J page
• IMPC: Eid3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGCTGCCATGCCAGACTC and CGTTATATCTTTGAGTTTAC, which resulted in a 998 bp deletion beginning at Chromosome 10 position 82,866,770 bp and ending after 82,867,767 bp (GRCm38/mm10). This mutation deletes 998 bp from ENSMUSE00001385020 (exon 1) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eid3 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)