Ppfibp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ppfibp1em1(IMPC)J |
Name: |
PTPRF interacting protein, binding protein 1 (liprin beta 1); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7518993 |
Gene: |
Ppfibp1 Location: Chr6:146789985-146933523 bp, + strand Genetic Position: Chr6, 77.7 cM, cytoband G3
|
Alliance: |
Ppfibp1em1(IMPC)J page
|
IMPC: |
Ppfibp1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGACTTTGATTTAGCGC and ATTGTGATCCTGTAAACTGC, which resulted in a 439 bp deletion beginning at Chromosome 6 position 146,997,890 bp and ending after 146,998,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294346 (exon 9) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 232 and early truncation 17 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|