Il1r1^em1Qizh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il1r1^em1Qizh
• Name: interleukin 1 receptor, type I; endonuclease-mediated mutation 1, Qing Zhou
• MGI ID: MGI:7519061
• Synonyms: Il1r1^R134E
• Gene: Il1r1 Location: Chr1:40264240-40356417 bp, + strand Genetic Position: Chr1, 18.81 cM
• Alliance: Il1r1^em1Qizh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 134 (CGG) in exon 4 was changed to glutamic acid (GAA) (p.R134E) using an sgRNA (targeting CACAGGCCACCTTCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.K131E mutation found in a patient suffering from erosive arthritis and osteomyelitis. (J:338375)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Il1r1 Mutation: 39 strains or lines available

References

• Original: J:338375 Wang Y, et al., Identification of an IL-1 receptor mutation driving autoinflammation directs IL-1-targeted drug design. Immunity. 2023 Jul 11;56(7):1485-1501.e7
• All: 1 reference(s)