Tmem161b^em3Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem161b^em3Jgg
• Name: transmembrane protein 161B; endonuclease-mediated mutation 3, Joseph G Gleeson
• MGI ID: MGI:7520092
• Synonyms: Tmem161b LOF
• Gene: Tmem161b Location: Chr13:84370415-84444085 bp, + strand Genetic Position: Chr13, 44.2 cM
• Alliance: Tmem161b^em3Jgg page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: Leucine codon 85 and tryptophan codon 317 were targeted for changing to arginine using sgRNAs (targeting CAGACTTGGTTTCTAGATGA and CATTTGATACTCTTCGACTC) and ssODN templates with CRISPR/Cas9 technology. This allele knockout allele, with an unspecified frameshifting genome sequence mutation, results from incorrect repair of the targeted sequence. (J:338312)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem161b Mutation: 55 strains or lines available

References

• Original: J:338312 Wang L, et al., TMEM161B modulates radial glial scaffolding in neocortical development. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2209983120
• All: 1 reference(s)