Slc25a32^em1Liliu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a32^em1Liliu
• Name: solute carrier family 25, member 32; endonuclease-mediated mutation 1, Li Liu
• MGI ID: MGI:7520348
• Synonyms: Slc25a32^Y174C
• Gene: Slc25a32 Location: Chr15:38954626-38976111 bp, - strand Genetic Position: Chr15, 15.39 cM
• Alliance: Slc25a32^em1Liliu page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 174 (TAT) in exon 4 was changed to cysteine (TGT) (c.521A>G, p.Y174C) using an sgRNA (targeting TATAAATATGAAGGTGTGCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). (J:338257)

Expression

In Mice Carrying this Mutation:	6 assay results
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc25a32 Mutation: 20 strains or lines available

References

• Original: J:338257 Peng MZ, et al., Mitochondrial FAD shortage in SLC25A32 deficiency affects folate-mediated one-carbon metabolism. Cell Mol Life Sci. 2022 Jun 21;79(7):375
• All: 1 reference(s)