About   Help   FAQ
Slc25a32em1Liliu
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a32em1Liliu
Name: solute carrier family 25, member 32; endonuclease-mediated mutation 1, Li Liu
MGI ID: MGI:7520348
Synonyms: Slc25a32Y174C
Gene: Slc25a32  Location: Chr15:38954626-38976111 bp, - strand  Genetic Position: Chr15, 15.39 cM
Alliance: Slc25a32em1Liliu page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 174 (TAT) in exon 4 was changed to cysteine (TGT) (c.521A>G, p.Y174C) using an sgRNA (targeting TATAAATATGAAGGTGTGCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). (J:338257)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 6 assay results
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slc25a32 Mutation:  20 strains or lines available
References
Original:  J:338257 Peng MZ, et al., Mitochondrial FAD shortage in SLC25A32 deficiency affects folate-mediated one-carbon metabolism. Cell Mol Life Sci. 2022 Jun 21;79(7):375
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory