Wdr24^em2Jiguo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr24^em2Jiguo
• Name: WD repeat domain 24; endonuclease-mediated mutation 2, Jianping Guo
• MGI ID: MGI:7520409
• Synonyms: Wdr24^S155D
• Gene: Wdr24 Location: Chr17:26042601-26047704 bp, + strand Genetic Position: Chr17, 12.92 cM
• Alliance: Wdr24^em2Jiguo page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 155 (TCT) in exon 1 was changed to aspartic acid (GAT) (p.S155D) using an sgRNA (targeting GTGCTTTGACCTCCGAAGGAAGG and GACTCTGTCAGCACCTTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the affected residue in the encoded peptide to a phosphomimetic. (J:338167)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Wdr24 Mutation: 46 strains or lines available

References

• Original: J:338167 Dai X, et al., AMPK-dependent phosphorylation of the GATOR2 component WDR24 suppresses glucose-mediated mTORC1 activation. Nat Metab. 2023 Feb;5(2):265-276
• All: 1 reference(s)