Tmem98^em1Siggs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem98^em1Siggs
• Name: transmembrane protein 98; endonuclease-mediated mutation 1, Owen M Siggs
• MGI ID: MGI:7520866
• Synonyms: Tmem98^A193P
• Gene: Tmem98 Location: Chr11:80701192-80712859 bp, + strand Genetic Position: Chr11, Syntenic
• Alliance: Tmem98^em1Siggs page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Alanine codon 193 (GCT) in exon 7 was changed to proline (CCT) (ENSMUST00000040865:c.577G>C, p.A193P) using an sgRNA (targeting CCAATCACTGTCTGCCGCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with nanophthalmos. (J:337903)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem98 Mutation: 25 strains or lines available

References

• Original: J:337903 Hassall MM, et al., Phenotypic consequences of a nanophthalmos-associated TMEM98 variant in human and mouse. Sci Rep. 2023 Jul 7;13(1):11017
• All: 1 reference(s)