About   Help   FAQ
Smarcb1em1Koke
Endonuclease-mediated Allele Detail
Summary
Symbol: Smarcb1em1Koke
Name: SWI/SNF related BAF chromatin remodeling complex subunit B1; endonuclease-mediated mutation 1, Kornelius Kerl
MGI ID: MGI:7520876
Synonyms: Smarcb11148del
Gene: Smarcb1  Location: Chr10:75732603-75757448 bp, - strand  Genetic Position: Chr10, 38.61 cM
Alliance: Smarcb1em1Koke page
Mutation
origin
Strain of Origin:  (C57BL/6J x DBA)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Intragenic deletion
 
Mutation detailsOne of coding cDNA C nucleotides at c.1145-1148 (GRCm39:chr10:g.75732893-75732896) was targeted for deletion using a crRNA (targeting GCCAACACTGCCCCAGCC) and an ssODN template (GGCGAATGAGGCGTCTTGCCAACACTGCCCAGCCTGGTGATGAAGACATCCATGCTCGAC) with CRISPR/Cas9 technology. The deletion causes a frameshift just before the stop codon, which replaces the last 3 endogenous codons with 35 non-endogenous codons. (J:337790)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Smarcb1 Mutation:  22 strains or lines available
References
Original:  J:337790 Brugmans AK, et al., A Carboxy-terminal Smarcb1 Point Mutation Induces Hydrocephalus Formation and Affects AP-1 and Neuronal Signalling Pathways in Mice. Cell Mol Neurobiol. 2023 May 23;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory