Ly6l^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ly6l^em1(IMPC)Tcp
• Name: lymphocyte antigen 6 family member L; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7524667
• Gene: Ly6l Location: Chr15:75321306-75323255 bp, + strand Genetic Position: Chr15, 34.37 cM
• Alliance: Ly6l^em1(IMPC)Tcp page
• IMPC: Ly6l gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGAGGCATGATGGTCAACG and ATGGTCATTGGGCAATACTC targeting from within exons ENSMUSE00000960385 to ENSMUSE00000952793. This resulted in a 1738-bp deletion of Chr15 from 75321375 to 75323112 (GRCm39) and a 40 bp insertion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ly6l Mutation: 7 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)