About   Help   FAQ
Polr1aem1Knwea
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr1aem1Knwea
Name: polymerase (RNA) I polypeptide A; endonuclease-mediated mutation 1, Kathryn Nicole Weaver
MGI ID: MGI:7526140
Synonyms: Polr1aC1559F
Gene: Polr1a  Location: Chr6:71886037-71956419 bp, + strand  Genetic Position: Chr6, 32.21 cM
Alliance: Polr1aem1Knwea page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsCysteine codon 1559 (TGC) in exon 31 was changed to phenylalanine (TTC) (c.4676G>T, p.C1559F) using an sgRNA (targeting TGTTGGTCGTTTCGTTCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4685G>T (p.Cys1562Phe) mutation associated with craniofacial, neural, and cardiac anomalies. (J:335489)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Polr1a Mutation:  94 strains or lines available
References
Original:  J:335489 Smallwood K, et al., POLR1A variants underlie phenotypic heterogeneity in craniofacial, neural, and cardiac anomalies. Am J Hum Genet. 2023 May 4;110(5):809-825
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory