Polr1a^em1Knwea
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr1a^em1Knwea
• Name: polymerase (RNA) I polypeptide A; endonuclease-mediated mutation 1, Kathryn Nicole Weaver
• MGI ID: MGI:7526140
• Synonyms: Polr1a^C1559F
• Gene: Polr1a Location: Chr6:71886037-71956419 bp, + strand Genetic Position: Chr6, 32.21 cM
• Alliance: Polr1a^em1Knwea page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 1559 (TGC) in exon 31 was changed to phenylalanine (TTC) (c.4676G>T, p.C1559F) using an sgRNA (targeting TGTTGGTCGTTTCGTTCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4685G>T (p.Cys1562Phe) mutation associated with craniofacial, neural, and cardiac anomalies. (J:335489)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Polr1a Mutation: 94 strains or lines available

References

• Original: J:335489 Smallwood K, et al., POLR1A variants underlie phenotypic heterogeneity in craniofacial, neural, and cardiac anomalies. Am J Hum Genet. 2023 May 4;110(5):809-825
• All: 1 reference(s)