About   Help   FAQ
Slc25a33em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a33em1(IMPC)J
Name: solute carrier family 25, member 33; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7526370
Gene: Slc25a33  Location: Chr4:149828493-149858734 bp, - strand  Genetic Position: Chr4, 80.15 cM, cytoband E1
Alliance: Slc25a33em1(IMPC)J page
IMPC: Slc25a33 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGCACCCCAGATACCTTG and GCATGAACATCCAGGTGCAG, which resulted in a 501 bp deletion beginning at Chromosome 4 position 149,753,556 bp and ending after 149,754,056 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184185 (exon 4) and 400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc25a33 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory