Cfap57^em1Qsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap57^em1Qsh
• Name: cilia and flagella associated protein 57; endonuclease-mediated mutation 1, Qinghua Shi
• MGI ID: MGI:7529021
• Synonyms: Cfap57^M
• Gene: Cfap57 Location: Chr4:118411748-118477974 bp, - strand Genetic Position: Chr4, 54.84 cM
• Alliance: Cfap57^em1Qsh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 18 was targeted with an sgRNA (targeting GGTCCTCTTCGCTTAAATACTAG) using CRISPR/Cas9 technology, resulting in a 7 bp deletion (GAAGCGA) that leads to a frameshift and premature stop codon (NM_026789.5:c.2865-2871del, p.K956Ffs*4). This mutation essentially mimics the human c.2872C>T (p.R958*) mutation associated with male infertility. (J:333969)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cfap57 Mutation: 87 strains or lines available

References

• Original: J:333969 Ma A, et al., Loss-of-function mutations in CFAP57 cause multiple morphological abnormalities of the flagella in humans and mice. JCI Insight. 2023 Feb 8;8(3)
• All: 1 reference(s)