Chchd10^em2Dpn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chchd10^em2Dpn
• Name: coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 2, Derek P Narendra
• MGI ID: MGI:7532644
• Synonyms: C10^S59L
• Gene: Chchd10 Location: Chr10:75768964-75773581 bp, + strand Genetic Position: Chr10, 38.62 cM
• Alliance: Chchd10^em2Dpn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 55 (TCA) in exon 3 was changed to leucine (CTG) (p.S55L) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTA) and an ssODN template using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S59L mutation found in a family with ALS, frontotemporal dementia (FTD) and myopathy. (J:295994)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chchd10 Mutation: 17 strains or lines available

References

• Original: J:295994 Liu YT, et al., Loss of CHCHD2 and CHCHD10 activates OMA1 peptidase to disrupt mitochondrial cristae phenocopying patient mutations. Hum Mol Genet. 2020 Jun 3;29(9):1547-1567
• All: 3 reference(s)