Cgas^em1Anda
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cgas^em1Anda
• Name: cyclic GMP-AMP synthase; endonuclease-mediated mutation 1, Andrea Ablasser
• MGI ID: MGI:7539420
• Synonyms: Cgas^R241E
• Gene: Cgas Location: Chr9:78337808-78350519 bp, - strand Genetic Position: Chr9, 43.65 cM
• Alliance: Cgas^em1Anda page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Null/knockout)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: Mutated exon 2, where arginine codon 241 (AGA) was changed to glutamic acid (p.R241E), was inverted, and a lox71 site was inserted into intron 1 and a lox66, in opposite direction, into intron 2 using sgRNAs (targeting TTTATAGGCACCCTATGTACAGG and CTGACCGCACGACTTACCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The allele is a knockout and only after Cre-mediated flipping of exon 2 will it express the mutated transcript/peptide. The mutation, the equivalent of the human p.R255E mutation, affects ageing-associated neurodegeneration. (J:340265)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cgas Mutation: 24 strains or lines available

References

• Original: J:340265 Gulen MF, et al., cGAS-STING drives ageing-related inflammation and neurodegeneration. Nature. 2023 Aug;620(7973):374-380
• All: 1 reference(s)