About   Help   FAQ
Cgasem1Anda
Endonuclease-mediated Allele Detail
Summary
Symbol: Cgasem1Anda
Name: cyclic GMP-AMP synthase; endonuclease-mediated mutation 1, Andrea Ablasser
MGI ID: MGI:7539420
Synonyms: CgasR241E
Gene: Cgas  Location: Chr9:78337808-78350519 bp, - strand  Genetic Position: Chr9, 43.65 cM
Alliance: Cgasem1Anda page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsMutated exon 2, where arginine codon 241 (AGA) was changed to glutamic acid (p.R241E), was inverted, and a lox71 site was inserted into intron 1 and a lox66, in opposite direction, into intron 2 using sgRNAs (targeting TTTATAGGCACCCTATGTACAGG and CTGACCGCACGACTTACCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The allele is a knockout and only after Cre-mediated flipping of exon 2 will it express the mutated transcript/peptide. The mutation, the equivalent of the human p.R255E mutation, affects ageing-associated neurodegeneration. (J:340265)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cgas Mutation:  23 strains or lines available
References
Original:  J:340265 Gulen MF, et al., cGAS-STING drives ageing-related inflammation and neurodegeneration. Nature. 2023 Aug;620(7973):374-380
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory