Wbp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wbp1^em1(IMPC)Tcp
• Name: WW domain binding protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7541412
• Gene: Wbp1 Location: Chr6:83096025-83098442 bp, - strand Genetic Position: Chr6, 35.94 cM
• Alliance: Wbp1^em1(IMPC)Tcp page
• IMPC: Wbp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTCCTAGAACACGCCTGAA targeting within ENSMUSE00001230083 and CCTGCCCGGCCCATCGCCAC targeting within ENSMUSE00000804494. The resulting 2221-bp deletion of Chr6 from 83096136 to 83098356 (GRCm39) deletes the full coding region. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wbp1 Mutation: 10 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)