Mib1^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mib1^em1Jlp
• Name: MIB E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543447
• Synonyms: Mib1^R530X
• Gene: Mib1 Location: Chr18:10725548-10818704 bp, + strand Genetic Position: Chr18, 5.35 cM
• Alliance: Mib1^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Single point mutation
• Mutation details: Arginine codon 530 (AGA) in exon 11 was changed to a stop codon (TGA) (p.R530*) using an sgRNA (targeting TACGCTTATTACGAGCATTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human missense mutation (c.1588C>T) found in some left ventricular noncompaction (LVNC) patients. (J:338889)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mib1 Mutation: 55 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)