Asxl3^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asxl3^em1Jlp
• Name: ASXL transcriptional regulator 3; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543632
• Synonyms: Asxl3^M1361V
• Gene: Asxl3 Location: Chr18:22477303-22663072 bp, + strand Genetic Position: Chr18, 11.96 cM
• Alliance: Asxl3^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6-Mib1^em1Jlp

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Methionine codon 1361 (ATG) in exon 13 was changed to valine (GTC) (p.M1361V) using a crRNA (targeting TCGCCCATCGCAATGTTTGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M1415V mutant (SNPs rs181303838) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1^em1Jlp allele and created at the same time as the Apcdd1^em1Jlp allele. (J:338889)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Asxl3 Mutation: 99 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)