About   Help   FAQ
Cep192em1Jlp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep192em1Jlp
Name: centrosomal protein 192; endonuclease-mediated mutation 1, Jose de la Pompa
MGI ID: MGI:7543635
Synonyms: Cep192T1522M
Gene: Cep192  Location: Chr18:67933177-68018241 bp, + strand  Genetic Position: Chr18, 40.11 cM, cytoband E1
Alliance: Cep192em1Jlp page
Mutation
origin
Strain of Origin:  C57BL/6-Mib1em2Jlp
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsThreonine codon 1522 (ACG) in exon 24 was changed to methionine (ATG) (p.T1522M) using a crRNA (targeting GGAAAACGTGAAACAGCGCC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.T1547M mutant (SNPs rs143331552) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Tmx3em1Jlp allele. (J:338889)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cep192 Mutation:  75 strains or lines available
References
Original:  J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory