Cep192^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep192^em1Jlp
• Name: centrosomal protein 192; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543635
• Synonyms: Cep192^T1522M
• Gene: Cep192 Location: Chr18:67933177-68018241 bp, + strand Genetic Position: Chr18, 40.11 cM, cytoband E1
• Alliance: Cep192^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6-Mib1^em2Jlp

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Threonine codon 1522 (ACG) in exon 24 was changed to methionine (ATG) (p.T1522M) using a crRNA (targeting GGAAAACGTGAAACAGCGCC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.T1547M mutant (SNPs rs143331552) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1^em2Jlp allele and created at the same time as the Tmx3^em1Jlp allele. (J:338889)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cep192 Mutation: 75 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)