Tmx3^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmx3^em1Jlp
• Name: thioredoxin-related transmembrane protein 3; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543636
• Synonyms: Tmx3^F191X
• Gene: Tmx3 Location: Chr18:90528336-90561391 bp, + strand Genetic Position: Chr18, 59.37 cM
• Alliance: Tmx3^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6-Mib1^em2Jlp

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Intragenic deletion
• Mutation details: Two nucleotides (TT) were deleted from intron 8 (c.579+8_579+9delTT) using a crRNA (targeting CTCAGAAGATGTGGTTCCTG) and an ssODN template with CRISPR/Cas9 technology. This sequence could represent the last two nucleotides of phenylalanine codon 196 (TTT) in an unannotated alternatively spliced transcript, equivalent to codon F193 (TTT) in the human TMX3-204 (ENST00000562706.5) transcript. Another human alternatively spliced transcript TMX3-202 (ENST00000443099.6) has a TT deletion in codon F191 (in its alternative 3' end in what is intron 9 sequence for transcript TMX3-201) (SNP rs143627864), which leads to a frameshift and resulting stop codon (TAA) in place of the phenylalanine codon (F191fs*), in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1^em2Jlp allele and created at the same time as the Cep192^em1Jlp allele. (J:338889)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmx3 Mutation: 27 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)