About   Help   FAQ
Tmx3em1Jlp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmx3em1Jlp
Name: thioredoxin-related transmembrane protein 3; endonuclease-mediated mutation 1, Jose de la Pompa
MGI ID: MGI:7543636
Synonyms: Tmx3F191X
Gene: Tmx3  Location: Chr18:90528336-90561391 bp, + strand  Genetic Position: Chr18, 59.37 cM
Alliance: Tmx3em1Jlp page
Mutation
origin
Strain of Origin:  C57BL/6-Mib1em2Jlp
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Intragenic deletion
 
Mutation detailsTwo nucleotides (TT) were deleted from intron 8 (c.579+8_579+9delTT) using a crRNA (targeting CTCAGAAGATGTGGTTCCTG) and an ssODN template with CRISPR/Cas9 technology. This sequence could represent the last two nucleotides of phenylalanine codon 196 (TTT) in an unannotated alternatively spliced transcript, equivalent to codon F193 (TTT) in the human TMX3-204 (ENST00000562706.5) transcript. Another human alternatively spliced transcript TMX3-202 (ENST00000443099.6) has a TT deletion in codon F191 (in its alternative 3' end in what is intron 9 sequence for transcript TMX3-201) (SNP rs143627864), which leads to a frameshift and resulting stop codon (TAA) in place of the phenylalanine codon (F191fs*), in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Cep192em1Jlp allele. (J:338889)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tmx3 Mutation:  27 strains or lines available
References
Original:  J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory