Bcl7a^em1Jlp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bcl7a^em1Jlp
• Name: B cell CLL/lymphoma 7A; endonuclease-mediated mutation 1, Jose de la Pompa
• MGI ID: MGI:7543637
• Synonyms: Bcl7a^AG,GA
• Gene: Bcl7a Location: Chr5:123482511-123512146 bp, + strand Genetic Position: Chr5, 62.92 cM, cytoband F
• Alliance: Bcl7a^em1Jlp page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Two mutations were introduced in intron 2 using a crNA (targeting TGGGGGCTCTGACTGTTTGA) and an ssODN template with CRISPR/Cas9 technology: c.175-106A>G and c.175-76G>A. These mutations are the equivalent of human SNPs rs884785 (c.175-56A>G) and rs884786 (c.175-27G>A) found in some left ventricular noncompaction (LVNC) patients. (J:338889)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Bcl7a Mutation: 27 strains or lines available

References

• Original: J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
• All: 1 reference(s)