Rab11b^em1Ngao
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab11b^em1Ngao
• Name: RAB11B, member RAS oncogene family; endonuclease-mediated mutation 1, Nan Gao
• MGI ID: MGI:7548551
• Gene: Rab11b Location: Chr17:33961458-33979460 bp, - strand Genetic Position: Chr17, 17.98 cM
• Alliance: Rab11b^em1Ngao page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology deleted exons 2-4 using gRNA target sequence 93 bp upstream of exon 2 (TCCGTGGGTGGCCAGAAATC) and gRNA target sequence 88 bp downstream of exon 4 (CCGGGTCTGGGTGGCCGTT). (J:278932)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rab11b Mutation: 20 strains or lines available

References

• Original: J:278932 D'Agostino L, et al., Recycling Endosomes in Mature Epithelia Restrain Tumorigenic Signaling. Cancer Res. 2019 Aug 15;79(16):4099-4112
• All: 3 reference(s)