Donson^em1Anpj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Donson^em1Anpj
• Name: downstream neighbor of SON; endonuclease-mediated mutation 1, Andrew P Jackson
• MGI ID: MGI:7565622
• Synonyms: Donson^M440T
• Gene: Donson Location: Chr16:91473696-91485658 bp, - strand Genetic Position: Chr16, 53.25 cM
• Alliance: Donson^em1Anpj page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Methionine codon 440 (ATG) in exon 8 was changed to threonine (ACG) (c.1319T>C, p.M440T) using an sgRNA (targeting TACCTTAAGCATTTGCATTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.M446T mutation associated with microcephalic dwarfism. (J:343338)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Donson Mutation: 25 strains or lines available

References

• Original: J:343338 Lim Y, et al., In silico protein interaction screening uncovers DONSON's role in replication initiation. Science. 2023 Aug 17;:eadi3448
• All: 1 reference(s)