Atp6v1b2^em1Pcamp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v1b2^em1Pcamp
• Name: ATPase, H+ transporting, lysosomal V1 subunit B2; endonuclease-mediated mutation 1, Philippe M Campeau
• MGI ID: MGI:7567698
• Synonyms: Atp6v1b2^emR506*
• Gene: Atp6v1b2 Location: Chr8:69541388-69566370 bp, + strand Genetic Position: Chr8, 33.88 cM
• Alliance: Atp6v1b2^em1Pcamp page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 506 (CGA) in exon 14 was changed to a stop codon (TAA) (p.R506*) using an sgRNA (targeting GAGCGAATTTTACCCTCGAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which truncates the encoded peptide by 6 C-terminal amino acids, is the equivalent of the human NM_001693.3:c.1516C>T p.R506* mutation associated with autosomal dominant congenital deafness with onychodystrophy (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). (J:342781)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp6v1b2 Mutation: 44 strains or lines available

References

• Original: J:342781 Rousseau J, et al., The ATP6V1B2 DDOD/DOORS-Associated p.Arg506* Variant Causes Hyperactivity and Seizures in Mice. Genes (Basel). 2023 Jul 27;14(8)
• All: 1 reference(s)