About   Help   FAQ
Atp6v1b2em1Pcamp
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp6v1b2em1Pcamp
Name: ATPase, H+ transporting, lysosomal V1 subunit B2; endonuclease-mediated mutation 1, Philippe M Campeau
MGI ID: MGI:7567698
Synonyms: Atp6v1b2emR506*
Gene: Atp6v1b2  Location: Chr8:69541388-69566370 bp, + strand  Genetic Position: Chr8, 33.88 cM
Alliance: Atp6v1b2em1Pcamp page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 506 (CGA) in exon 14 was changed to a stop codon (TAA) (p.R506*) using an sgRNA (targeting GAGCGAATTTTACCCTCGAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which truncates the encoded peptide by 6 C-terminal amino acids, is the equivalent of the human NM_001693.3:c.1516C>T p.R506* mutation associated with autosomal dominant congenital deafness with onychodystrophy (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). (J:342781)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Atp6v1b2 Mutation:  44 strains or lines available
References
Original:  J:342781 Rousseau J, et al., The ATP6V1B2 DDOD/DOORS-Associated p.Arg506* Variant Causes Hyperactivity and Seizures in Mice. Genes (Basel). 2023 Jul 27;14(8)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/02/2024
MGI 6.13
The Jackson Laboratory