Npl^em1Avps
Endonuclease-mediated Allele Detail

Summary

• Symbol: Npl^em1Avps
• Name: N-acetylneuraminate pyruvate lyase; endonuclease-mediated mutation 1, Alexey Pshezhetsky
• MGI ID: MGI:7567785
• Synonyms: Npl^R63C
• Gene: Npl Location: Chr1:153378762-153425460 bp, - strand Genetic Position: Chr1, 65.38 cM, cytoband G2
• Alliance: Npl^em1Avps page

Mutation origin

• Strain of Origin: C57BL/6NHsd

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 63 (CGT) in exon 4 was changed to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with sialic acid metabolism disorder leading to cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss. Transcripts are expressed from this allele but not proteins. (J:342764)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Npl Mutation: 38 strains or lines available

References

• Original: J:342764 Da Silva A, et al., N-acetylneuraminate pyruvate lyase controls sialylation of muscle glycoproteins essential for muscle regeneration and function. Sci Adv. 2023 Jun 30;9(26):eade6308
• All: 1 reference(s)