Npl^em2Avps
Endonuclease-mediated Allele Detail

Summary

• Symbol: Npl^em2Avps
• Name: N-acetylneuraminate pyruvate lyase; endonuclease-mediated mutation 2, Alexey Pshezhetsky
• MGI ID: MGI:7567786
• Synonyms: Npl^del116
• Gene: Npl Location: Chr1:153378762-153425460 bp, - strand Genetic Position: Chr1, 65.38 cM, cytoband G2
• Alliance: Npl^em2Avps page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Arginine codon 63 (CGT) in exon 4 was targeted for change to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. This allele has an unintended 116 bp deletion of the 3' end of intron 3 and the 5' end of exon 4 (GRCm39:chr1:153411645-153411760). No transcripts are expressed from this allele. (J:342764)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Npl Mutation: 38 strains or lines available

References

• Original: J:342764 Da Silva A, et al., N-acetylneuraminate pyruvate lyase controls sialylation of muscle glycoproteins essential for muscle regeneration and function. Sci Adv. 2023 Jun 30;9(26):eade6308
• All: 1 reference(s)