Dnaaf5^em1Slb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnaaf5^em1Slb
• Name: dynein, axonemal assembly factor 5; endonuclease-mediated mutation 1, Steven L Brody
• MGI ID: MGI:7569243
• Synonyms: Dnaaf5^C498F
• Gene: Dnaaf5 Location: Chr5:139135978-139172265 bp, + strand Genetic Position: Chr5, 78.02 cM
• Alliance: Dnaaf5^em1Slb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 498 (TGT) in exon 7 was changed to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1499G>T (p.C500F) mutation associated with primary ciliary dyskinesia (PCD). (J:342770)

Disease models

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnaaf5 Mutation: 48 strains or lines available

References

• Original: J:342770 Horani A, et al., The effect of Dnaaf5 gene dosage on primary ciliary dyskinesia phenotypes. JCI Insight. 2023 Jun 8;8(11)
• All: 1 reference(s)