Dnaaf5^em3Slb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnaaf5^em3Slb
• Name: dynein, axonemal assembly factor 5; endonuclease-mediated mutation 3, Steven L Brody
• MGI ID: MGI:7569317
• Gene: Dnaaf5 Location: Chr5:139135978-139172265 bp, + strand Genetic Position: Chr5, 78.02 cM
• Alliance: Dnaaf5^em3Slb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 21 bp deletion was created in exon 4 (CAGACAGCCACCAGCCTATGG) using an sgRNA (targeting GCAGACAGCCACCAGCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The in-frame deletion, at the 5' end of the exon, may affect the splice acceptor site and deletes codons for critical residues in the encoded peptide. (J:342770)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnaaf5 Mutation: 48 strains or lines available

References

• Original: J:342770 Horani A, et al., The effect of Dnaaf5 gene dosage on primary ciliary dyskinesia phenotypes. JCI Insight. 2023 Jun 8;8(11)
• All: 1 reference(s)