Sqstm1^em2Kmts
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sqstm1^em2Kmts
• Name: sequestosome 1; endonuclease-mediated mutation 2, Masaaki Komatsu
• MGI ID: MGI:7570168
• Synonyms: p62^S351A
• Gene: Sqstm1 Location: Chr11:50090193-50101654 bp, - strand Genetic Position: Chr11, 30.36 cM, cytoband B1.2
• Alliance: Sqstm1^em2Kmts page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 351 (TCT) was changed to alanine (GCC) (p.S351A) using an sgRNA (targeting ACTGGAGTTCACCTGTAGAT) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the residue in the encoded peptide. (J:342766)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sqstm1 Mutation: 34 strains or lines available

References

• Original: J:342766 Ikeda R, et al., Phosphorylation of phase-separated p62 bodies by ULK1 activates a redox-independent stress response. EMBO J. 2023 Jul 17;42(14):e113349
• All: 1 reference(s)