Cryab^em1Mtc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cryab^em1Mtc
• Name: crystallin, alpha B; endonuclease-mediated mutation 1, Michael T Chin
• MGI ID: MGI:7571352
• Synonyms: Cryab^R123W
• Gene: Cryab Location: Chr9:50662625-50667936 bp, + strand Genetic Position: Chr9, 27.75 cM
• Alliance: Cryab^em1Mtc page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 123 (CGG) in exon 3 was changed to tryptophan (TGG) (p.R123W) using an sgRNA (targeting CCGGATCCCAGCCGATGTGGATC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation associated with hypertrophic cardiomyopathy (HCM). (J:342762)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cryab Mutation: 13 strains or lines available

References

• Original: J:342762 Chou C, et al., A novel alphaB-crystallin R123W variant drives hypertrophic cardiomyopathy by promoting maladaptive calcium-dependent signal transduction. Front Cardiovasc Med. 2023;10:1223244
• All: 1 reference(s)